KWMTBOMO03670

Position

ChromosomeChr6
Start15263090
End15269820
Strand+

view in Gbrowse: Chr6:15263090..15269820

Most similar sequence in NCBI nr database

AccessionDescriptionE-valueScore
XP_028044214.1glutathione S-transferase 1-1-like isoform X65e-157447

ORF sequence (663 bp)

ATGGCAATAGATCTATACTTCACCGCGGGATCGGCGCCGTGCCGCGTCGTGCTGCTAGTGGCAGCCGCTTTGGACCTACAGCTCAACCTTAAACCTCTTAATTTGTGGGAGGGAGAACAGTTGCAAGCCGATTACTTAAAGTTGAATCCTCAACACACAGTCCCTACAATAGTGGACGAGGGCTTCCCTCTGTGGGAGTCGCGAGCGATAAGCAGATATTTAGTCAACAAGTACGGAGGAGACAGTAGCAGTCTCTATCCGAAGGATTTGATGGCAAGGGCCCTCGTCGATCAGAGACTTGACTTCGACATTGGAACTTTGTACCCTAGATTCGCACAATATTTTTATCCCCAAGTATTTGGCGGAGCGAAACCCGATGCAGCATCCCTTAAAAAATTAGAGGAAGCGCTGGTATTCCTCAACGCTTTCCTGGAAGGTCAGAAATATGTAACCGGAGACGTATTGACTATCGCCGATCTCAGCCTTGTGGCTACCATCTCCACTATTGACGGGGCTGAAATCAGTCTGAAGAGTTACCCTAATGTGGAGAAATGGTTTGAGCTCATGAAGACAACAGCTCCAGATTATCAGAATGCTAATCAAAAAGGTATCGATGAATTCAAGAAGTTGATAGCGCAAATGAAGGCCAAAACTGAACTTTGA

Protein sequence (220 aa)

MAIDLYFTAGSAPCRVVLLVAAALDLQLNLKPLNLWEGEQLQADYLKLNPQHTVPTIVDEGFPLWESRAISRYLVNKYGGDSSSLYPKDLMARALVDQRLDFDIGTLYPRFAQYFYPQVFGGAKPDAASLKKLEEALVFLNAFLEGQKYVTGDVLTIADLSLVATISTIDGAEISLKSYPNVEKWFELMKTTAPDYQNANQKGIDEFKKLIAQMKAKTEL

Corresponding sequences in KAIKObase version 1

BMgn002210

Domains and motifs

DatabaseIDDescriptionStartEndEvalueInterPro ID
Gene3D3.40.30.10- 1793.7e-24 -
ProSiteProfilesPS50404Soluble glutathione S-transferase N-terminal domain profile. 18221.688 IPR004045
SUPERFAMILYSSF52833- 2883.4e-23 IPR036249
CDDcd03045GST_N_Delta_Epsilon 3763.1e-38 -
PANTHERPTHR43969- 32162.3e-79 -
PANTHERPTHR43969:SF9- 32162.3e-79 -
PfamPF13417Glutathione S-transferase, N-terminal domain 5806.0e-13 IPR004045
SUPERFAMILYSSF47616- 731972.1e-29 IPR036282
Gene3D1.20.1050.10- 822171.0e-49 -
ProSiteProfilesPS50405Soluble glutathione S-transferase C-terminal domain profile. 8921120.167 IPR010987
CDDcd03177GST_C_Delta_Epsilon 932084.5e-54 -
PfamPF00043Glutathione S-transferase, C-terminal domain 1271881.0e-07 IPR004046

InterPro assignment

InterPro IDInterPro description
IPR004045Glutathione S-transferase, N-terminal
IPR004046Glutathione S-transferase, C-terminal
IPR010987Glutathione S-transferase, C-terminal-like
IPR036249Thioredoxin-like superfamily
IPR036282Glutathione S-transferase, C-terminal domain superfamily

Gene ontology (GO) assignment

GO categoryGO IDGO description
molecular functionGO:0005515protein binding
SpeciesAccession
Danaus plexippus -
Heliconius melpomene -
Manduca sextaXP_030035463.1
Plutella xylostellag37534.t1
Spodoptera frugiperda (corn)GSSPFG00008244001.4-PA
Spodoptera frugiperda (rice)SFRICE000656.2-PA
Acyrthosiphon pisum -
Aedes aegypti -
Anopheles gambiae -
Apis mellifera -
Drosophila melanogaster -
Tribolium castaneum -
Homo sapiens -
Mus musculus -

The expression data was obtained from RNA-seq data of ten tissues/locations.
Three replicates were sequenced from each tissue/location.

The Y axis is the abundance value (transcripts per million (TPM))
The X axis is the tissues/locations with the following abbreviations:
ASG: anterior silk gland; FB: fat body; MG: midgut;
MSG_A: middle silk gland (anterior); MSG_M: middle silk gland (middle); MSG_P: middle silk gland (posterior);
MT: Malpighian tubules; OV: ovary; PSG: posterior silk gland; TT: testis

For more details, please refer to the article "Reference transcriptome data in silkworm Bombyx mori" (Yokoi et al., 2019).
Expression data (TPM) can be obtained from National Bioscience Database Center.

Expression data of KWMTBOMO03670:

The expression data was obtained from RNA-seq data of ten tissues/locations.
Three replicates were sequenced from each tissue/location.

The Y axis is the abundance value with log10 conversion (value of transcripts per million (TPM) plus 1 is used to avoid negative output)
The X axis is the tissues/locations with the following abbreviations:
ASG: anterior silk gland; FB: fat body; MG: midgut;
MSG_A: middle silk gland (anterior); MSG_M: middle silk gland (middle); MSG_P: middle silk gland (posterior);
MT: Malpighian tubules; OV: ovary; PSG: posterior silk gland; TT: testis

For more details, please refer to the article "Reference transcriptome data in silkworm Bombyx mori" (Yokoi et al., 2019).
Expression data (TPM) can be obtained from National Bioscience Database Center.

Expression data of KWMTBOMO03670: